Part:BBa_K4197008

OmpA_Ara h 2 fusion

Gene fusion to express the peanut allergen Ara h 2 on the surface of E. coli.

Introduction

This part is composed of the gene coding for the allergen of peanut Ara h 2 (NCBI: AY158467.1). The peanut allergy prevalence is higher than 5% (Lieberman and al. 2018) in developped countries and Ara h 2, among the 17 other peanut allergens, triggers 90% of peanut allergies (Lehmann and al. 2003). Ara h 2 have already been expressed in E. coli and was able to bind the IgE of patient with peanut's allergie (Lehmann and al. 2003). Ara h 2 was merged to the membrane protein OmpA of E. coli (BBa_K1694002) to display Ara h on the surface of E. coli. This lipoprotein is the most abundant in E. coli membrane with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display protein on the surface of bacteria (Yang and al. 2016).

Construction

Ara h 2 gene ordered on IDT was amplified by PCR using the high fidelity Phusion polymerase with primers IF3_allergen F (gccgcaagctttaatgatggtgatggtgatggtgatg) and IF4_Ara h 2 (cctgtattttcagagcatggccaagctcaccattc). Expected size of the amplicon was 567 bp.

To merge Ara h 2 to OmpA, the gene was inserted in a pET-21 b (+) plasmid containing OmpA merged to Gal d 2, another allergen. The plasmid was linearized, excluding the Gal d 2 fragment by PCR. The primers used were IF1_allergen and IF2_plasmid. Expected size of the amplicon was 5924 bp.

Amplification product sizes were checked on Ethidium bromide stained agarose gel (Figure 6).

Figure 6: pET-21 b (+)_OmpA linearized with Gal d 2 exclusion (A) and Ara h 2 amplified fragment (B). Expected sizes of the amplicons were 5924 bp (A) and 567 bp (B). PCR amplicon sizes of pET-21 b (+)_OmpA (A) and Ara h 2 (B) were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).

Amplification products matched expected sizes, they were further purified from the gel.

The Ara h 2 fragment was then inserted into pET-21 b (+)_OmpA by In-Fusion. The In-Fusion assemby reaction was transformed into Stellar competent cells. Transformants were selected on LB-ampicillin plates. 15 transformants were then screened by colony PCR with primer pairs flanking the insertion zone (primers used: screening_inserts-F: ggttatgctagttattgctcagc and screening_inserts-R: ccgaaacaagcgctcatgagc, expected size of the amplicons: 1450 bp). 13 positive transformants were detected (Figure 7).

Figure 7: Identifying strains that bear pET21 b (+)_OmpA_Ara h 2 by colony PCR. The expected size of the amplicons was 1450 bp. 13 positive transformants were detected. PCR amplicon sizes of colonies with Ara h 2 plasmid were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).

Four of these transformants (colonies 21, 22, 23, 24) had their plasmid extracted by Miniprep. Sequences were all validated by Sanger sequencing. The plasmid was named pET-21 b (+)_OmpA_Ara h 2.

The plasmid was finally used to transform E. coli Tuner cells to express OmpA_Ara h 2 at the cell membrane.

Expression controls

We assessed the expression of the allergens at the outer surface of the bacteria, an important control experiment prior to aggregation experiments. Two experiments were conducted to do so: one with a fluorescent anti-HIS-tag IgG and one with an IgE coupled to a fluorescent anti-IgE IgG.

Test of Ara h 2 protein expression by HIS-tag detection

As the protein was HIS-tagged, we first tried to detect it by binding a fluorescent anti-HIS-tag IgG to the cell membrane and measuring fluorescence. Cells without IgG were observed as negative control. Microscope observations are shown in Figure 16. The microscope parameters to observe GFP were the following: excitation filter 360/40, dichroic beamsplitter 400 nm, emission filter 470/40.

Figure 16: fluorescence of E. coli Tuner cells containing the pET-21 b (+)_OmpA_Ara h 2 vector mixed with 1:100 anti-HIS-tag IgG (A), or without IgG for negative control (B). Each image represents an observation in phase contrast (on the left) and in fluorescence (on the right). Observations were made at the microscope parameters for GFP.

No difference in fluorescence was visible between the control and the sample. The only fluorescence observed was due to autofluorescence of cells, so we could not conclude if the protein was expressed at the membrane, especially without a positive control (like binding the protein to a HIS-tag resin and observing fluorescence).

Test of the allergens functionality by double antibody recognition (ELISA test)

We assessed the functionality of the allergens by binding specific IgE to them (anti-Ara h 2 and anti-Der p 1), and then binding a fluorescent anti-IgE IgG to the complex. No fluorescence was observed in either case (data not shown). Without a positive control, we could not conclude between an incorrect exposition of the protein (not facing the outer surface), or a mere problem during the experimental setup.

Conclusion

In conclusion, validation remains to be performed to assess this part functionality.